244x Filetype PPTX File size 2.79 MB Source: media.tghn.org
Our Mtb DNA on the Tapestation MinION fastq file 2 records – 576 bp; 1316 bp Illumina fastq file all records ~100 bp There are 3 main approaches to sequencing Market Approach / USP Read Achievements Ideal for: dominance length st 1 Generation Applied Sequencing by 1 kb Most primary PCR products (Sanger) Biosystems synthesis (SBS) drafts, e.g. (genotyping) - Low throughput Mtb, human nd 2 Illumina SBS 100 bp Cheap, rapid WGS Generation (IonTorrent) - Massively parallel resequencing - Very high of millions of throughput genomes rd 3 Oxford Single molecule 100 bp – Sequencing in Real-time Generation Nanopore sequencing (SMS) 500 Mbp field / very sequencing (PacBio) long lengths All genomes are ‘assembled’ by piecing together small fragments into a consensus (‘shotgun sequencing’) GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG GGCACCAGCCAGCTGAGCCAATTCATGGACCAGTACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG GGCACCAGCCAGCTGAGCCCATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG Consensus • The first full assembly of any genome from scratch (de novo) and its annotation is hard • It’s a hypothesis of a genome at a moment in time • Overlapping sequences extends consensus, and improves evidence for each base call • Errors occur for many reasons
no reviews yet
Please Login to review.